shRNA Adeno-associated Virus Serotype 2, pU6-(Pof1b-shRNA-Seq5)(CAT#: AAV-SI1776WQ)

This product is a Pof1b-shRNA encoding AAV, which is based on AAV-2 serotype. The Pof1b gene is expressed at trace levels in mouse prenatal ovary and is barely detectable or absent from adult ovary, in human and in the mouse respectively. The expression of Pof1b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Pof1b-shRNA-Seq5
Related Target/Protein Pof1b
Region 3UTR
TargetSeq CATTAAGCTTGTGACTAATAG
NCBI RefSeq NM_181579
Alternative Names POF; POF2B
Titer >1*10^10 GC/mL
Related Diseases Premature ovarian failure
Target Gene
Gene ID 79983
Uniprot ID Q8WVV4

Related Products

Inquiry Now
Advertisement