shRNA Adeno-associated Virus Serotype 2, pU6-(Pppde1-shRNA-Seq1)(CAT#: AAV-SI1971WQ)

This product is a Pppde1-shRNA encoding AAV, which is based on AAV-2 serotype. The Pppde1 gene has deubiquitinating activity. The expression of Pppde1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Pppde1-shRNA-Seq1
Related Target/Protein Pppde1
Region CDS
TargetSeq GGGCGTCACACTAAACTATAA
NCBI RefSeq NM_024282
Alternative Names DESI; DESI1; DeSI-2; PNAS-4; PPPDE1; CGI-146; FAM152A; C1orf121; DESI2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 51029
Uniprot ID Q9BSY9

Related Products

Advertisement