shRNA Adeno-associated Virus Serotype 2, pU6-(Prlhr-shRNA-Seq1)(CAT#: AAV-SI2325WQ)

This product is a Prlhr-shRNA encoding AAV, which is based on AAV-2 serotype. The Prlhr gene is a 7-transmembrane domain receptor for prolactin-releasing hormone that is highly expressed in anterior pituitary. The expression of Prlhr-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Prlhr-shRNA-Seq1
Related Target/Protein Prlhr
Region 3UTR
TargetSeq GATCTTATTCCCAGCACCAAA
NCBI RefSeq NM_201615
Alternative Names GR3; GPR10; PrRPR
Titer >1*10^10 GC/mL
Target Gene
Gene ID 2834
Uniprot ID P49683

Related Products

Advertisement