shRNA Adeno-associated Virus Serotype 2, pU6-(Psme4-shRNA-Seq1)(CAT#: AAV-SI1721WQ)

This product is a Psme4-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Psme4 gene is associated component of the proteasome that specifically recognizes acetylated histones and promotes ATP- and ubiquitin-independent degradation of core histones during spermatogenesis and DNA damage response. The expression of Psme4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Psme4-shRNA-Seq1
Related Target/Protein Psme4
Region CDS
TargetSeq GCGTTGGCTGAACAAGTTAAT
NCBI RefSeq NM_134013
Alternative Names PA200
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 23198
Uniprot ID Q14997

Related Products