shRNA Adeno-associated Virus Serotype 2, pU6-(Pus7-shRNA-Seq5)(CAT#: AAV-SI1787WQ)

This product is a Pus7-shRNA encoding AAV, which is based on AAV-2 serotype. The Pus7 gene encodes pseudouridylate synthase that catalyzes pseudouridylation of RNAs. The expression of Pus7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Pus7-shRNA-Seq5
Related Target/Protein Pus7
Region CDS
TargetSeq CCCACCTACATTGAGGAAGAT
NCBI RefSeq NM_178403
Alternative Names IDDABS
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54517
Uniprot ID Q96PZ0

Related Products

Inquiry Now
Advertisement