shRNA Adeno-associated Virus Serotype 2, pU6-(Reep4-shRNA-Seq1)(CAT#: AAV-SI2327WQ)
This product is a Reep4-shRNA encoding AAV, which is based on AAV-2 serotype. The Reep4 gene probably acts by clearing the endoplasmic reticulum membrane from metaphase chromosomes. The expression of Reep4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Reep4-shRNA-Seq1 |
Related Target/Protein | Reep4 |
Region | 3UTR |
TargetSeq | GCACAGGGAGACATTCACTAT |
NCBI RefSeq | NM_180588 |
Alternative Names | PP432; Yip2c; C8orf20 |
Titer | >1*10^10 GC/mL |