shRNA Adeno-associated Virus Serotype 2, pU6-(SCAF1-shRNA-Seq1)(CAT#: AAV-SI0278WQ)

This product is a SCAF1-shRNA encoding AAV, which is based on AAV-2 serotype. The SCAF1 may function in pre-mRNA splicing. The expression of SCAF1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SCAF1-shRNA-Seq1
Related Target/Protein SCAF1
Region CDS
TargetSeq CCCAATGATAAAGATGGCTCT
NCBI RefSeq NM_021228
Alternative Names SRA1
Titer >1*10^10 GC/mL
Related Diseases Atherosclerosis
Target Gene
Gene ID 58506
Uniprot ID Q9H7N4

Related Products

Inquiry Now
Advertisement