shRNA Adeno-associated Virus Serotype 2, pU6-(Selm-shRNA-Seq1)(CAT#: AAV-SI2302WQ)

This product is a Selm-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Selm gene belongs to the selenoprotein M/SEP15 family and may be involved in neurodegenerative disorders. The expression of Selm-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Selm-shRNA-Seq1
Related Target/Protein Selm
Region CDS
TargetSeq CTGTGGAGGATGACAGTTGAA
NCBI RefSeq NM_053267
Alternative Names SELM; SEPM; SELENOM
Titer >1*10^10 GC/mL
Related Diseases Neurodegenerative disorders
Target Gene
Gene ID 140606
Uniprot ID Q8WWX9

Related Products