shRNA Adeno-associated Virus Serotype 2, pU6-(SESTD1-shRNA-Seq1)(CAT#: AAV-SI0283WQ)
This product is a SESTD1-shRNA encoding AAV, which is based on AAV-2 serotype. The SESTD1 gene may act as the primary docking protein directing membrane turnover and assembly of the transient receptor potential channels TRPC4 and TRPC5. The expression of SESTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SESTD1-shRNA-Seq1 |
Related Target/Protein | SESTD1 |
Region | CDS |
TargetSeq | GATTAACTGTTCCAGTAGTTT |
NCBI RefSeq | NM_178123 |
Alternative Names | SOLO |
Titer | >1*10^10 GC/mL |
Related Diseases | Lithium-responsive bipolar disorder |