shRNA Adeno-associated Virus Serotype 2, pU6-(SGMS2-shRNA-Seq1)(CAT#: AAV-SI2097WQ)

This product is a SGMS2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by SGMS2 gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The expression of SGMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SGMS2-shRNA-Seq1
Related Target/Protein SGMS2
Region 3UTR
TargetSeq GCTGTAACCAAAGGTATAGTT
NCBI RefSeq NM_152621
Alternative Names CDL; SMS2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 166929
Uniprot ID Q8NHU3

Related Products

Inquiry Now
Advertisement