shRNA Adeno-associated Virus Serotype 2, pU6-(VARS2-shRNA-Seq1)(CAT#: AAV-SI1533WQ)
This product is a VARS2-shRNA encoding AAV, which is based on AAV-2 serotype. The VARS2 encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. The expression of VARS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | VARS2-shRNA-Seq1 |
Related Target/Protein | VARS2 |
Region | CDS |
TargetSeq | GACTCGCGATACACACATCTA |
NCBI RefSeq | NM_020442 |
Alternative Names | VALRS; VARSL; VARS2L; COXPD20 |
Titer | >1*10^10 GC/mL |
Related Diseases | oxidative phosphorylation deficiency-20 |