shRNA Adeno-associated Virus Serotype 2, pU6-(VARS2-shRNA-Seq1)(CAT#: AAV-SI1533WQ)

This product is a VARS2-shRNA encoding AAV, which is based on AAV-2 serotype. The VARS2 encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. The expression of VARS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert VARS2-shRNA-Seq1
Related Target/Protein VARS2
Region CDS
TargetSeq GACTCGCGATACACACATCTA
NCBI RefSeq NM_020442
Alternative Names VALRS; VARSL; VARS2L; COXPD20
Titer >1*10^10 GC/mL
Related Diseases oxidative phosphorylation deficiency-20
Target Gene
Gene ID 57176
Uniprot ID Q5ST30

Related Products

Advertisement