shRNA Adeno-associated Virus Serotype 2, pU6-(WDR25-shRNA-Seq2)(CAT#: AAV-SI0364WQ)

This product is a WDR25-shRNA encoding AAV, which is based on AAV-2 serotype. The WD domains of WDR25 gene are involved in protein-protein interactions in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The expression of WDR25-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert WDR25-shRNA-Seq2
Related Target/Protein WDR25
Region 3UTR
TargetSeq CTCAAGGGTAGATGAGAGGAA
NCBI RefSeq NM_024515
Alternative Names C14orf67
Titer >1*10^10 GC/mL
Target Gene
Gene ID 79446
Uniprot ID Q64LD2

Related Products

Inquiry Now
Advertisement