shRNA Adeno-associated Virus Serotype 2, pU6-(XKR6-shRNA-Seq5)(CAT#: AAV-SI2000WQ)

This product is a XKR6-shRNA encoding AAV, which is based on AAV-2 serotype. The XKR6 gene may play an important role in cell apoptotic process. The expression of XKR6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert XKR6-shRNA-Seq5
Related Target/Protein XKR6
Region 3UTR
TargetSeq GCAAAGTCTTGCCAGAGATAT
NCBI RefSeq NM_173683
Alternative Names XRG6; C8orf5; C8orf7; C8orf21
Titer >1*10^10 GC/mL
Target Gene
Gene ID 286046
Uniprot ID Q5GH73

Related Products