shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(6430548M08Rik-shRNA-Seq1)(CAT#: AdV-SI4019WQ)

This product is a 6430548M08Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 6430548M08Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 6430548M08Rik-shRNA-Seq1
Related Target/Protein 6430548M08Rik
Region CDS
TargetSeq CAATGAGTCCTTCTCCTCCAA
NCBI RefSeq NM_172286
Alternative Names AW049007; Kiaa0513; mKIAA0513
Titer >1*10^10 GC/mL
Target Gene
Gene ID 234797
Uniprot ID D3YUS2

Related Products