shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(BOD1-shRNA-Seq1)(CAT#: AdV-SI1186WQ)
This product is a BOD1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The BOD1 gene is required for proper chromosome biorientation through the detection or correction of syntelic attachments in mitotic spindles. The expression of BOD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | BOD1-shRNA-Seq1 |
Related Target/Protein | BOD1 |
Region | CDS |
TargetSeq | GCCACAAATAGAACGAGCAAT |
NCBI RefSeq | NM_138369 |
Alternative Names | FAM44B |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |