shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C10orf27-shRNA-Seq3)(CAT#: AdV-SI1483WQ)
This product is a C10orf27-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C10orf27 gene encodes a protein that regulates thymic epithelial cell proliferation and thymus size. It has been identified as a ligand for the class I human leukocyte antigen (HLA-I) in thymus. The expression of C10orf27-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | C10orf27-shRNA-Seq3 |
Related Target/Protein | C10orf27 |
Region | CDS |
TargetSeq | GAAGAAAGAGAAGGAGCAGAA |
NCBI RefSeq | NM_152710 |
Alternative Names | SPATIAL; TBATA |
Titer | >1*10^10 GC/mL |
Related Diseases | Multiple sclerosis (MS) |