shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C20orf43-shRNA-Seq2B)(CAT#: AdV-SI3702WQ)
This product is a C20orf43-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The C20orf43 gene may be required for ATR pathway signaling upon DNA damage and has a positive activity during DNA replication and function to facilitate fork pausing at replication fork barriers like the rDNA. The expression of C20orf43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | C20orf43-shRNA-Seq2B |
Related Target/Protein | C20orf43 |
Region | CDS |
TargetSeq | GATGATGTCATCGTGCTCAAT |
NCBI RefSeq | NM_016407 |
Alternative Names | CDAO5; RTFDC1; HSPC164; RTF2; SHUJUN-3 |
Titer | >1*10^10 GC/mL |