shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C5orf13-shRNA-Seq2)(CAT#: AdV-SI1459WQ)
This product is a C5orf13-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C5orf13 gene may have roles in neural function and cellular differentiation. The expression of C5orf13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | C5orf13-shRNA-Seq2 |
Related Target/Protein | C5orf13 |
Region | CDS |
TargetSeq | CAAGAACCATTTCCAAACAAG |
NCBI RefSeq | NM_004772 |
Alternative Names | P311; PTZ17; SEZ17; D4S114; NREP; PRO1873 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast Cancer |