shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Csrnp1-shRNA-Seq1)(CAT#: AdV-SI3464WQ)

This product is a Csrnp1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Csrnp1 gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The expression of Csrnp1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Csrnp1-shRNA-Seq1
Related Target/Protein Csrnp1
Region CDS
TargetSeq CTGTGCCAGTGTAAGGATTAA
NCBI RefSeq NM_153287
Alternative Names AXUD1; URAX1; TAIP-3; CSRNP-1; FAM130B
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 64651
Uniprot ID Q96S65

Related Products