shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Defb34-shRNA-Seq1)(CAT#: AdV-SI4045WQ)

This product is a Defb34-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Defb34 gene has antibacterial activity. The expression of Defb34-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Defb34-shRNA-Seq1
Related Target/Protein Defb34
Region CDS
TargetSeq GCAGCAGGATTAATGGGAGAT
NCBI RefSeq NM_183035
Alternative Names BD-34
Titer >1*10^10 GC/mL
Target Gene
Gene ID 360211
Uniprot ID Q7TNV8

Related Products