shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(DPY19L4-shRNA-Seq1)(CAT#: AdV-SI3888WQ)
This product is a DPY19L4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by DPY19L4 gene is probable C-mannosyltransferase that mediates C-mannosylation of tryptophan residues on target proteins. The expression of DPY19L4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | DPY19L4-shRNA-Seq1 |
Related Target/Protein | DPY19L4 |
Region | CDS |
TargetSeq | CGGAACTTATTGCTAGCATTT |
NCBI RefSeq | NM_181787 |
Titer | >1*10^10 GC/mL |