shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Iqcf4-shRNA-Seq1)(CAT#: AdV-SI3933WQ)

This product is a Iqcf4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Iqcf4 gene has calmodulin binding ability. The expression of Iqcf4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Iqcf4-shRNA-Seq1
Related Target/Protein Iqcf4
Region CDS
TargetSeq GACATAAAGGAAACAAGGAAA
NCBI RefSeq NM_026090
Alternative Names mtIQ1; 1700042N06Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 67320
Uniprot ID Q6P8Y2

Related Products