shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(PIGW-shRNA-Seq1)(CAT#: AdV-SI1141WQ)

This product is a PIGW-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by PIGW gene is an inositol acyltransferase that acylates the inositol ring of phosphatidylinositol. Defects in this gene are a cause of the age-dependent epileptic encephalopathy West syndrome as well as a syndrome exhibiting hyperphosphatasia and cognitive disability (HPMRS5). The expression of PIGW-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PIGW-shRNA-Seq1
Related Target/Protein PIGW
Region CDS
TargetSeq GCCCTCGGCATTACTGTATTA
NCBI RefSeq NM_178517
Alternative Names Gwt1; HPMRS5
Titer >1*10^10 GC/mL
Related Diseases Hyperphosphatasia and mental retardation syndrome
Target Gene
Gene ID 284098
Uniprot ID Q7Z7B1

Related Products