shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(KIAA1841-shRNA-Seq1)(CAT#: AdV-SI1220WQ)
This product is a KIAA1841-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. KIAA1841 is targeted for the nucleus and it predicted to play a role in regulating transcription. The expression of KIAA1841-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | KIAA1841-shRNA-Seq1 |
| Related Target/Protein | KIAA1841 |
| Region | 3UTR |
| TargetSeq | CCATGCATGTTGTTATACTTT |
| NCBI RefSeq | NM_032506 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung adenocarcinoma |
