shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(KLHL7-shRNA-Seq2)(CAT#: AdV-SI1065WQ)

This product is a KLHL7-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The KLHL7 encoded protein may be involved in protein degradation. Mutations in this gene have been associated with retinitis pigmentosa 42. The expression of KLHL7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert KLHL7-shRNA-Seq2
Related Target/Protein KLHL7
Region CDS
TargetSeq GAACTGAAAGCTGGCACACAA
NCBI RefSeq NM_018846
Alternative Names CISS3; KLHL6; SBBI26
Titer >1*10^10 GC/mL
Related Diseases Retinitis pigmentosa
Target Gene
Gene ID 55975
Uniprot ID Q8IXQ5

Related Products