shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LOC392563-shRNA-Seq3)(CAT#: AdV-SI3266WQ)

This product is a LOC392563-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by LOC392563 gene is a component of the mature neuronal cytoskeleton, and it interacts with the zygosome, which is mediated by neurofilament-related proteins. The expression of LOC392563-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert LOC392563-shRNA-Seq3
Related Target/Protein LOC392563
Region CDS
TargetSeq CCGGATAATTACGATCCGATA
NCBI RefSeq XM_373382
Titer >1*10^10 GC/mL
Related Diseases Neurodegenerative diseases

Related Products