shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Mrpl14-shRNA-Seq1)(CAT#: AdV-SI4042WQ)
This product is a Mrpl14-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Mrpl14 gene encodes a protein component of the 39S subunit of the mitochondrial ribosome. The expression of Mrpl14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Mrpl14-shRNA-Seq1 |
| Related Target/Protein | Mrpl14 |
| Region | CDS |
| TargetSeq | CCTCATTGAGGACAATGGCAA |
| NCBI RefSeq | NM_026732 |
| Alternative Names | L14mt; L32mt; MRPL32; RMPL32; RPML32; MRP-L14; MRP-L32 |
| Titer | >1*10^10 GC/mL |
