shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(NECAP1-shRNA-Seq3)(CAT#: AdV-SI1474WQ)
This product is a NECAP1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The NECAP1 gene encodes a protein containing two characteristic WXXF motifs and the encoded protein localizes to clathrin-coated vesicles, where it binds components of the adapter protein complexes and aids in endocytosis. The expression of NECAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | NECAP1-shRNA-Seq3 |
Related Target/Protein | NECAP1 |
Region | CDS |
TargetSeq | CGCAGTGCTTTCATTGGCATT |
NCBI RefSeq | NM_015509 |
Alternative Names | EIEE21 |
Titer | >1*10^10 GC/mL |
Related Diseases | Retinal Degeneration |