shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C10orf67-shRNA-Seq3)(CAT#: AdV-SI0268WQ)
This product is a C10orf67-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C10orf67-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C10orf67-shRNA-Seq3 |
| Related Target/Protein | C10orf67 |
| Region | 3UTR |
| TargetSeq | GCCTTAAACTTCTGGACTCAA |
| NCBI RefSeq | NM_153714 |
| Alternative Names | C10orf115; LINC01552 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Sarcoidosis and Crohn's disease |
