shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Olfr410-shRNA-Seq1)(CAT#: AdV-SI4009WQ)

This product is a Olfr410-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Olfr410 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr410-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Olfr410-shRNA-Seq1
Related Target/Protein Olfr410
Region CDS
TargetSeq CTTAGTCCATAAGCGTACAAT
NCBI RefSeq NM_146707
Alternative Names MOR255-5
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258702
Uniprot ID Q8VFX7

Related Products