shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(RNPS1-shRNA-Seq3)(CAT#: AdV-SI1053WQ)

This product is a RNPS1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The RNPS1 gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The expression of RNPS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert RNPS1-shRNA-Seq3
Related Target/Protein RNPS1
Region CDS
TargetSeq TCTGTCCAAAGGCTATGCGTA
NCBI RefSeq NM_006711
Alternative Names E5.1
Titer >1*10^10 GC/mL
Related Diseases Neuro-developmental disorders
Target Gene
Gene ID 10921
Uniprot ID Q15287

Related Products