shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(TMEM44-shRNA-Seq1)(CAT#: AdV-SI1467WQ)
This product is a TMEM44-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. TMEM44 gene encodes a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. The expression of TMEM44-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | TMEM44-shRNA-Seq1 |
Related Target/Protein | TMEM44 |
Region | CDS |
TargetSeq | CGCTGCTTCTCTATCTGAGAT |
NCBI RefSeq | NM_138399 |
Titer | >1*10^10 GC/mL |