shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(TTC1-shRNA-Seq2)(CAT#: AdV-SI1147WQ)

This product is a TTC1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The TTC1 gene encoded protein plays a role in protein-protein interactions, and binds to the Galpha subunit of G protein-coupled receptors to activate the Ras signaling pathway. The expression of TTC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert TTC1-shRNA-Seq2
Related Target/Protein TTC1
Region 3UTR
TargetSeq CCTGATGTAATGAACCTAATT
NCBI RefSeq NM_003314
Alternative Names TPR1
Titer >1*10^10 GC/mL
Related Diseases Medullary Thyroid Cancer
Target Gene
Gene ID 7265
Uniprot ID Q99614

Related Products