shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(1500015O10Rik-shRNA-Seq1)(CAT#: AdV-SI3086WQ)
This product is a 1500015O10Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The products of 1500015O10Rik gene is probable hormone that may attenuate cell proliferation and induce senescence of oligodendrocyte and neural precursor cells in the central nervous system. The expression of 1500015O10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | 1500015O10Rik-shRNA-Seq1 |
| Related Target/Protein | 1500015O10Rik |
| Region | CDS |
| TargetSeq | CCGAGAACACAGCAAAGGAAT |
| NCBI RefSeq | NM_024283 |
| Alternative Names | Ecrg4 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Nervous system disease |
