shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Dos-shRNA-Seq1)(CAT#: AdV-SI2294WQ)

This product is a Dos-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Dos gene negatively regulates voltage-gated calcium channels by preventing the interaction between their alpha and beta subunits. The expression of Dos-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Dos-shRNA-Seq1
Related Target/Protein Dos
Region CDS
TargetSeq GCCGACTTCATTCAGTACATT
NCBI RefSeq NM_015761
Alternative Names DOS; BARP; C19orf26; CBARP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 255057
Uniprot ID Q8N350

Related Products