shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(4930447C04Rik-shRNA-Seq4)(CAT#: AdV-SI2715WQ)
This product is a 4930447C04Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 4930447C04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | 4930447C04Rik-shRNA-Seq4 |
| Related Target/Protein | 4930447C04Rik |
| Region | CDS |
| TargetSeq | GCCATGTGAGTCTCAGAAATT |
| NCBI RefSeq | NM_029444 |
| Alternative Names | Six6OS; Six6as; Six6os1; 4921504I02Rik; A930035O15Rik |
| Titer | >1*10^10 GC/mL |
