shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SDK2-shRNA-Seq1)(CAT#: AdV-SI0892WQ)

This product is a SDK2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by SDK2 gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. The expression of SDK2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SDK2-shRNA-Seq1
Related Target/Protein SDK2
Region CDS
TargetSeq GATCCGCTACATTCTGGAGAT
NCBI RefSeq NM_019064
Titer >1*10^10 GC/mL
Related Diseases Retina desease
Target Gene
Gene ID 54549
Uniprot ID Q58EX2

Related Products