shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(A730089K16Rik-shRNA-Seq1)(CAT#: AdV-SI3125WQ)

This product is a A730089K16Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of A730089K16Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert A730089K16Rik-shRNA-Seq1
Related Target/Protein A730089K16Rik
Region 3UTR
TargetSeq CGGAAGCTAATAGGAAACTTT
NCBI RefSeq NM_177156
Titer >1*10^10 GC/mL
Target Gene
Gene ID 320411
Uniprot ID Q8C904

Related Products

Advertisement