shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(A130030D10Rik-shRNA-Seq1)(CAT#: AdV-SI3095WQ)

Datasheet

This product is a A130030D10Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by A130030D10Rik gene may play a role in Shh signaling by mediating the ubiquitination of Kif7. The expression of A130030D10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert A130030D10Rik-shRNA-Seq1
Related Target/Protein A130030D10Rik
Region 3UTR
TargetSeq CGCTAACACTTTGCTGTATTT
NCBI RefSeq NM_177783
Alternative Names Zfp650; Znf650; AA409735; AA414972; AA422631; AI646861; AU016126; 1110059H15Rik; 4833421P10Rik; Ubr3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 68795
Uniprot ID Q5U430

Related Products

shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SPANXN4-shRNA-Seq1) (CAT#:AdV-SI0350WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C15orf45-shRNA-Seq1) (CAT#:AdV-SI0857WQ) Recombinant adenovirus, pU6-(Human Hpse), Overexpression (CAT#:AdV-GTOH0066WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Chst15-shRNA-Seq1) (CAT#:AdV-SI1750WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(KHDRBS1-shRNA-Seq2) (CAT#:AdV-SI1047WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Zcchc5-shRNA-Seq1) (CAT#:AdV-SI2218WQ) Recombinant adenovirus, pU6-(Mouse Tfeb), Overexpression (CAT#:AdV-GTOH0544WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(FANCI-shRNA-Seq2) (CAT#:AdV-SI1341WQ)