shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(APBA3-shRNA-Seq1)(CAT#: AdV-SI0812WQ)

This product is a APBA3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by APBA3 gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. The expression of APBA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert APBA3-shRNA-Seq1
Related Target/Protein APBA3
Region CDS
TargetSeq CTATGGCGAGGTGCATATCAA
NCBI RefSeq NM_004886
Alternative Names X11L2; mint3; MGC:15815
Titer >1*10^10 GC/mL
Related Diseases Alzheimer's disease
Target Gene
Gene ID 9546
Uniprot ID O96018

Related Products