shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(TREH-shRNA-Seq1)(CAT#: AdV-SI0870WQ)
This product is a TREH-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The TREH gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. The expression of TREH-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | TREH-shRNA-Seq1 |
Related Target/Protein | TREH |
Region | CDS |
TargetSeq | GAATCGCTATTATGTCCCTTA |
NCBI RefSeq | NM_007180 |
Alternative Names | TRE; TREA; TREHD |
Titer | >1*10^10 GC/mL |
Related Diseases | Motoneuron degeneration |