shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CAMSAP1-shRNA-Seq3)(CAT#: AdV-SI0805WQ)
This product is a CAMSAP1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CAMSAP1 encoded protein is a key microtubule-organizing protein that specifically binds the minus-end of non-centrosomal microtubules and regulates their dynamics and organization. The expression of CAMSAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | CAMSAP1-shRNA-Seq3 |
Related Target/Protein | CAMSAP1 |
Region | CDS |
TargetSeq | GCCATTAGTGTTGAAGCCGAA |
NCBI RefSeq | NM_015447 |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular Carcinoma |