shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CDCA3-shRNA-Seq3)(CAT#: AdV-SI0625WQ)

This product is a CDCA3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. CDCA3 is a potential prognostic marker that promotes cell proliferation in gastric cancer. CDCA3 overexpression resulted in the stimulation of cell growth and colony formation in vitro and xenograft tumors in vivo. Conversely, knockdown of CDCA3 inhibited these effects. The expression of CDCA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CDCA3-shRNA-Seq3
Related Target/Protein CDCA3
Region CDS
TargetSeq CTCCCAGATCTTCAGGTTCTA
NCBI RefSeq NM_031299
Alternative Names GRCC8; TOME-1
Titer >1*10^10 GC/mL
Related Diseases Gastric cancer
Target Gene
Gene ID 83461
Uniprot ID Q99618

Related Products