shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Cma2-shRNA-Seq1)(CAT#: AdV-SI3070WQ)

This product is a Cma2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Zcchc5 gene has serine-type endopeptidase activity. The expression of Cma2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Cma2-shRNA-Seq1
Related Target/Protein Cma2
Region 3UTR
TargetSeq CATCAGAGTCTTCAAGCCAGA
NCBI RefSeq NM_001024714
Alternative Names Mcp10
Titer >1*10^10 GC/mL
Target Gene
Gene ID 545055
Uniprot ID A0A2I3BR33

Related Products