shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Ctu2-shRNA-Seq3)(CAT#: AdV-SI2640WQ)

This product is a Ctu2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Ctu2 gene a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs) and plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. The expression of Ctu2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Ctu2-shRNA-Seq3
Related Target/Protein Ctu2
Region CDS
TargetSeq CAGAGCAGTTATGTTATAGCT
NCBI RefSeq NM_153775
Alternative Names MFRG; NCS2; UPF0432; C16orf84
Titer >1*10^10 GC/mL
Target Gene
Gene ID 348180
Uniprot ID Q2VPK5

Related Products