shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(DDX10-shRNA-Seq1)(CAT#: AdV-SI0648WQ)

This product is a DDX10-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. DDX10 gene is implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. The expression of DDX10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert DDX10-shRNA-Seq1
Related Target/Protein DDX10
Region CDS
TargetSeq CCAGTGCTGGAAGCCTTATAT
NCBI RefSeq NM_004398
Alternative Names Dbp4; HRH-J8
Titer >1*10^10 GC/mL
Related Diseases Myeloid malignancies
Target Gene
Gene ID 1662
Uniprot ID Q13206

Related Products