shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(EFCAB4A-shRNA-Seq2)(CAT#: AdV-SI1392WQ)
This product is a EFCAB4A-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The EFCAB4A gene plays a role in store-operated Ca2+ entry (SOCE). The expression of EFCAB4A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | EFCAB4A-shRNA-Seq2 |
Related Target/Protein | EFCAB4A |
Region | CDS |
TargetSeq | GCAGAAAGAGAAAGTCAGCCT |
NCBI RefSeq | NM_173584 |
Alternative Names | CRACR2B |
Titer | >1*10^10 GC/mL |
Related Diseases | Chronic bronchitis |