shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(ENSMUSG00000063277-shRNA-Seq6)(CAT#: AdV-SI3050WQ)
This product is a ENSMUSG00000063277-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of ENSMUSG00000063277-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | ENSMUSG00000063277-shRNA-Seq6 |
Related Target/Protein | ENSMUSG00000063277 |
Region | CDS |
TargetSeq | CCAAGGAACAGCAGTGTGATA |
NCBI RefSeq | NM_025940 |
Alternative Names | Gm10128 |
Titer | >1*10^10 GC/mL |