shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(F8-shRNA-Seq2)(CAT#: AdV-SI0761WQ)
This product is a F8-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The F8 gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. The expression of F8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | F8-shRNA-Seq2 |
Related Target/Protein | F8 |
Region | 3UTR |
TargetSeq | GCCTCCTGAATTAACTATCAT |
NCBI RefSeq | NM_000132 |
Alternative Names | AHF; F8B; F8C; HEMA; FVIII; DXS1253E |
Titer | >1*10^10 GC/mL |
Related Diseases | Hemophilia A, a common recessive X-linked coagulation disorder |