shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(FAM70A-shRNA-Seq2)(CAT#: AdV-SI0653WQ)

This product is a FAM70A-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. TMEM255A is often referred to as family with sequence similarity 70, member A (FAM70A). The TMEM255A protein is transmembrane and is predicted to be located the nuclear envelope of eukaryote organisms. The expression of FAM70A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert FAM70A-shRNA-Seq2
Related Target/Protein FAM70A
Region CDS
TargetSeq GCCACCATATTCTGCTTATGA
NCBI RefSeq NM_017938
Alternative Names Tmem255a; 4933417N17; 6430550H21Rik
Titer >1*10^10 GC/mL
Related Diseases Glioblastoma multiforme
Target Gene
Gene ID 245386
Uniprot ID Q5JRV8

Related Products